Sequence gapdh FR AACCCATCACCATCTTCCAG CACGACATACTCAGCACCAG NM_017008/4 74 myoD FR TCTGATGGCATGATGGATTACTAGTAGGCGGCGTCGTAG NM_176079/1 74 تجزیه وتحلیل داده ها
داده های به دست آمده از دستگاه Real Time PCR که به صورت CT (میانگین CT برای هر نمونه) بودند، با استفاده از نرم افزار Excel به ΔΔct تبدیل شدند، سپس با استفاده از فرمول ΔΔct-2 اعداد نهایی بهدست آمد. با انتقال این اعداد به نرم افزار SPSS، ابتدا پرت بودن داده ها بررسی شد که مشخص شد داده پرتی وجود ندارد. سپس نرمال بودن توزیع داده ها با استفاده از آزمون Shapiro-Wilk ارزیابی و مشخص شد که دادهها توزیع طبیعی دارند. سپس با استفاده از آزمونLevene مساوی
بودن واریان سها ارزیابی شد. نتایج این آزمون نشان داد که واریانس ها در عضلات نعلی و EDL همگن هستند. در ادامه از آزمونهای آماری t یک نمونه برای تعیین اختلاف بین گروه کنترل (شاخص عدد 1 1 است) و گروههای تجربی و برای تعیین اختلاف میانگین در هر عضله (در ساعات 3 و 6 پس از تمرین مقاومتی) از آزمون t مستقل استفاده شد.
نتایج
در عضله EDL مقدار بیان ژن myoD 3 و 6 ساعت پس از تمرین مقاومتی به ترتیب 36/2 و 56/1 برابر افزایش یافت (شکل 1)، اما نتایج آزمون t یکنمونه ای نشان داد که تغییر بیان ژن myoD عضله EDL نسبت به گروه کنترل در 3 (279/ P =) و 6 (111/ P =) ساعت پس از تمرین مقاومتی معنادار نیست.
همچنین مقدار t مستقل (711/) نشان داد که بین 3 و 6 ساعت پس از تمرین مقاومتی تفاوت معناداری (513/ P =) در بیان ژن myoD وجود ندارد.

شکل1. تأثیر یک جلسه تمرین مقاومتی بر بیان myod عضله EDL در 3 و 6 ساعت پس از یک جلسه تمرین مقاومتی نسبت به سطح پایه [خط منقطع (گروه کنترل)]

شکل 2. نمایش محصول PCR ژن myoD عضله EDL، از چپ گروه کنترل، گروه 3 ساعت، گروه 6 ساعت و gapdh

در عضله نعلی مقدار بیان ژن myoD 3 و 6 ساعت پس از تمرین مقاومتی بهترتیب 9/0 و 58/1 برابر افزایش یافت (شکل 3)، اما نتایج آزمون t یک نمونه ای نشان داد که تغییر بیان ژن myoD عضله نعلی نسبت به گروه کنترل در 3 (59/ P =) و 6 (352/ P =) ساعت پس از تمرین مقاومتی معنادار نیست. همچنین مقدار t مستقل (79/1 -) نشان داد بین 3 و 6 ساعت پس از تمرین مقاومتی تفاوت معناداری (294/ P =) در بیان ژن myoD وجود ندارد.

شکل 3. تأثیر یک جلسه تمرین مقاومتی بر بیان myod عضله نعلی در 3 و 6 ساعت پس از یک جلسه تمرین مقاومتی نسبت به سطح پایه [خط منقطع (گروه کنترل)]

شکل 4. نمایش محصول PCR ژن myoD عضله نعلی، از چپ گروه کنترل، گروه 3 ساعت، گروه 6
gapdh ساعت و

بحث و نتیجه گیری
نتایج تحقیق نشان داد که بیان ژن myoD در پاسخ به یک جلسه تمرین مقاومتی در عضله تندانقباض، متفاوت از عضله کندانقباض است، درحالی که بیان آن در عضله EDL بیشتر از دو برابر افزایش نشان داد، هرچند معنادار نبود، اما بیان آن در عضله نعلی تنها به 58/1 برابر در شش ساعت پس از تمرین رسید. تحقیقات نشان داده اند که مقدار myoD در عضله نعلی تحت تأثیر تمرینات استقامتی حاد (با پروتکل متفاوت) قرار نمی گیرد (12) که با یافته های این تحقیق همخوانی دارد. اما پاسخ عضله پهن جانبی اندکی متفاوت است. برای مثال پژوهش Vissing (2008) نشان داد که یک جلسه فعالیت استقامتی (90 دقیقه تمرین دوچرخه سواری در 60 درصد VO2peakدر افراد سالم) موجب افزایش بیانmRNA فاکتورهای MyoD در عضله پهن جانبی می شود (13). یک جلسه تمرین قدرتی نیز موجبافزایش بیان ژن myoD در عضله پهن جانبی افراد جوان و پیر، چهار ساعت پس از تمرین میشود (7). شایان یادآوری است که عضله پهن جانبی در نمونه های انسانی یک عضله بینابینی محسوب می شود، اما عضله نعلی در رتها یک عضله کاملاً کند بهحساب میآید (19). به نظر میرسد ترکیب نوع تار بر پاسخ این ژن به تمرین تأثیر می گذارد. در تأیید این ادعا در تحقیقی گزارش شد که یک جلسه تمرین مقاومتی در عضله پهن جانبی آزمودنیهای انسانی موجب افزایش بیان ژن moyD بلافاصله و شش ساعت پس از جلسه تمرینی میشود که این همزمان بود با افزایش mRNA ایزوفرمMHC IIa ، بلافاصله بعد از تمرین و همچنین افزایش mRNA ایزوفرمهای MHC IIa ،MHC I و MHC IIx، شش ساعت پس از تمرین. در تحقیق ذکرشده مقدار بیان پروتئین ها نیز اندازه گیری شد. نتایج نشان داد که مقدار پروتئین myoD، شش ساعت پس از تمرین افزایش معناداری می یابد (20). ژن myoD تحت تأثیر تمرینات بلندمدت نیز قرار میگیرد. برای مثال Liu و همکاران در سال 2007 نشان دادند که تمرینات قدرتی (شش هفته) در نمونه های انسانی به طور معناداری سبب افزایش بیان ژن myoD در عضله سه سر بازو (عضله تندانقباض) می شود (15).
برخی تحقیقات بیان ژن myoD را شش ساعت پس از تمرین دانستهاند (3)، اما برخی نتایج نیز خلاف این ادعا را نشان میدهد، برای مثال دیده شد که یک جلسه تمرین مقاومتی شدید در عضله پهن جانبی (نمونه انسانی) بلافاصله پس از تمرین، مقدار بیان ژن myoD را 100 تا 400 درصد افزایش داد، این در حالی بود که تا 48 ساعت پس از تمرین، تغییری مشاهده نشد (21). در تحقیقی دیگر، یک جلسه تمرین قدرتی در عضله بازکننده پا در نمونه های انسانی موجب افزایش بیان ژن myoD تا 8 ساعت پس از تمرین شد که این افزایش پس از 20 ساعت ناپدید شد (22). بهنظر میرسد نوع عضله، نوع تمرین و مدل آزمودنی بر بیان این ژن تأثیرگذار است، به همین دلیل تناقضاتی در نتایج وجود دارد.
البته باید گفت برخی نتایج نیز افزایش بیان ژن myoD در اثر تمرینات (چه پاسخ، چه سازگاری) ورزشی را تأیید نکردهاند. برای نمونه دیده شد که یک جلسه تمرین قدرتی در نمونههای انسانی بر بیان myoD عضله پهن جانبی اثر معناداری ندارد (6). همچنین تمرین قدرتی به مدت هشت هفته بر بیان myoD mRNA پهن جانبی در نمونه های انسانی (با سطح تستوتسترون طبیعی یا کاهش یافته) تأثیر معناداری ندارد (23). در تحقیقی، Drummond (2008) نشان داد که myoD در عضله پهن جانبی، تحت تأثیر یک جلسه تمرین (مقاومتی در نمونه های انسانی) و مصرف محرک آنابولیکی (در آن ساعاتاندازه گیری) قرار نمیگیرد (24)، که این یافتهها با یافته تحقیق حاضر همخوانی دارد، هرچندتفاوت هایی در مدل آزمودنی (انسانی و حیوانی) و نوع پروتکل وجود دارد. علاوه بر تمرینات بدنی، القاکننده فعالیت های بدنی (تحریک الکتریکی مزمن) یا کشش بهتنهایی نیز بر بیان myoD اثر دارند.
برای مثال Vissing (2005) گزارش کرد که تحریک الکتریکی با فرکانس 10 هرتز و 5 ثانیه استراحت (القاکننده تمرینات استقامتی) موجب افزایش بیان تارهای کند در پایان هفته چهارم در عضله درشت نی قدامی (تار تندانقباض) می شود که این موضوع با افزایش بیان MyoD mRNA در همان زمان همراه بود (25)، یا 24 ساعت پس از کشش عضله نعلی رت (26) مقدار MyoD افزایش یافت. از طرف دیگر تمریناتی که موجب آسیب عضلانی شدند، بیان myoD را زیاد تحت تأثیر قرار ندادند. برای مثال در مدلهای حیوانی (رت) مشاهده شد که یک جلسه تمرین تردمیل فزاینده با شیب منفی (القاکننده آسیب عضلانی) بر بیان MyoD mRNA عضلات نعلی و بازکننده ها اثر معناداری ندارد (27). هرچند گزارش شده که بازسازی عضلات آسیبدیده نعلی رت با فعالیت های ورزشی ( فعالیتهای شدید و اختیاری) تشدید میشود که این موضوع با افزایش مقدار پروتئین myoD همراه بود (28). افزایش بیان ژن myoD نشانه تکثیر سلول های ماهواره ای است و تکثیر این سلولها زمانی بیشتر می شود که آسیب (فارماکولوژی، پاتولوژی یا فعالیت های قدرتی) عضلانی رخ دهد (10). با وجود معنادار نبودن، اما 36/2 برابر افزایش در بیان ژن myoDاحتمالاً ناشی از این موضوع است که تمرین قدرتی (پروتکل این تحقیق) توانسته موجب آسیب تمرینی در عضله EDL و فعال سازی سلولهای ماهواره ای، به تبع آن افزایش مارکر این سلولها یعنی ژن myoD شود.
در تعمیم یافتهها و اعلام نتایج پایانی این موضوع که آیا تمرین بر بیان ژن myoD عضله تأثیر دارد، باید به مدل آزمودنی، نوع پروتکل، نوع عضله، سن آزمودنی ها، روش های اندازهگیری بیان ژن دقت کرد، همچنین باید پروسه پاسخ و سازگاری را از هم جدا کرد.

نتیجه گیری کلی
ژن myoD در عضله تندانقباض نسبت به عضله کندانقباض سریعتر و بیشتر تحت تأثیر تمرین مقاومتی قرار می گیرد، به طوری که یک جلسه تمرین مقاومتی در ساعات اولیه پس از تمرین موجب افزایش بیان 36/2 برابری اما غیرمعنادار ژن myoD در عضلات EDL می شود. در همان زمان مقدارآن در عضله نعلی کاهش مییابد. سپس در شش ساعت پس از تمرین مقدار بیان این ژن در هر دوعضله یکسان می شود. این موضوع در شکل 5 نشان داده شده است.

شکل 5. روند تغییرات بیان ژن myoD در گروه کنترل 3 و 6 ساعت پس از یک جلسه تمرین مقاومتی در عضله EDL و نعلی
تقدیر و تشکر
این مقاله حاصل رساله دکتری گرایش فیزیولوژی ورزش گروه تربیت بدنی دانشکده علوم انسانی دانشگاه تربیت مدرس است. از تمام دوستانی که در انجام این پژوهش با اینجانب همکاری کردند، صمیمانه سپاسگزارم. همچنین از حمایت مالی دانشگاه تربیت مدرس بهدلیل تأمین اعتبارات این پژوهش سپاسگزاری می شود.
منابع و مĤخذ
Megeney, L.A., et al., MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes & Development, 1996. 10(10): p. 1173-
1183.
Biressi, S. and T.A. Rando, Heterogeneity in the muscle satellite cell population. Seminars in Cell & Developmental Biology, 2010. 21(8): p. 845-854.
Hawke, T.J. and D.J. Garry, Myogenic satellite cells: physiology to molecular biology. J Appl Physiol, 2001. 91(2): p. 534-51.
Holterman, C.E. and M.A. Rudnicki, Molecular regulation of satellite cell function. Seminars in Cell & Developmental Biology, 2005. 16(4-5): p. 575-584.
Zammit, P.S., All muscle satellite cells are equal, but are some more equal than others? Journal of Cell Science, 2008. 121(18): p. 2975-2982.
Hameed, M., et al., Expression of IGF-I splice variants in young and old human skeletal muscle after high resistance exercise. The Journal of Physiology, 2002. 547(1): p. 247-254.
Raue, U., et al., Myogenic gene expression at rest and after a bout of resistance exercise in young (18-30 yr) and old (80-89 yr) women. J Appl Physiol, 2006. 101(1): p. 53-9.
Hughes, S.M., et al., MyoD protein is differentially accumulated in fast and slow skeletal muscle fibres and required for normal fibre type balance in rodents. Mech Dev, 1997. 61(1-2): p. 151-63.
Tamaki, T., et al., Limited myogenic response to a single bout of weightlifting exercise in old rats. Am J Physiol Cell Physiol, 2000. 278(6): p. C1143-52.
Snijders, T., L.B. Verdijk, and L.J.C. van Loon, The impact of sarcopenia and exercise training on skeletal muscle satellite cells. Ageing Research Reviews, 2009. 8(4): p. 328-338.
Schultz, E. and K.M. McCormick, Skeletal muscle satellite cells. Rev Physiol Biochem Pharmacol, 1994. 123: p. 213-257.

در این سایت فقط تکه هایی از این مطلب با شماره بندی انتهای صفحه درج می شود که ممکن است هنگام انتقال از فایل ورد به داخل سایت کلمات به هم بریزد یا شکل ها درج نشود

شما می توانید تکه های دیگری از این مطلب را با جستجو در همین سایت بخوانید

ولی برای دانلود فایل اصلی با فرمت ورد حاوی تمامی قسمت ها با منابع کامل

اینجا کلیک کنید

Smith, H.K., et al., Exercise-enhanced satellite cell proliferation and new myonuclear accretion in rat skeletal muscle. J Appl Physiol, 2001. 90(4): p. 1407-14.
Vissing, K., et al., Effect of sex differences on human MEF2 regulation during endurance exercise. Am J Physiol Endocrinol Metab, 2008.
294(2): p. E408-15.
Favier, F.B., H. Benoit, and D. Freyssenet, Cellular and molecular events controlling skeletal muscle mass in response to altered use. Pflugers Arch, 2008. 456(3): p. 587-600.
Liu, Y., et al., Response of growth and myogenic factors in human skeletal muscle to strength training. British Journal of Sports Medicine, 2007. 42(12): p. 989-993.
Godfrey, J., et al., Interrupted Resistance Training and BMD in Growing Rats. International Journal of Sports Medicine, 2009. 30(08): p. 579-584.
Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8.
Silver, N., et al., Selection of housekeeping genes for gene expression studies in the adult rat submandibular gland under normal, inflamed, atrophic and regenerative states. BMC Mol Biol, 2008. 9: p. 64.
Talmadge, R.J., Myosin heavy chain isoform expression following reduced neuromuscular activity: potential regulatory mechanisms. Muscle Nerve, 2000. 23(5): p. 661-79.
Willoughby, D.S. and M.J. Nelson, Myosin heavy-chain mRNA expression after a single session of heavy-resistance exercise. Med Sci Sports Exerc, 2002. 34(8): p. 1262-9.
Psilander, N., R. Damsgaard, and H. Pilegaard, Resistance exercise alters MRF and IGF-I mRNA content in human skeletal muscle. J Appl
Physiol, 2003. 95(3): p. 1038-44.
Vissing, K., J.L. Andersen, and P. Schjerling, Are exercise-induced genes induced by exercise? FASEB J, 2005. 19(1): p. 94-6.
Kvorning, T., et al., Suppression of testosterone does not blunt mRNA expression of myoD, myogenin, IGF, myostatin or androgen receptor post strength training in humans. The Journal of Physiology, 2006. 578(2): p. 579-593.
Drummond, M.J., et al., Aging differentially affects human skeletal muscle microRNA expression at rest and after an anabolic stimulus of resistance exercise and essential amino acids. Am J Physiol Endocrinol Metab, 2008. 295(6): p. E1333-40.
Vissing, K., et al., Gene expression of myogenic factors and phenotypespecific markers in electrically stimulated muscle of paraplegics. J Appl Physiol, 2005. 99(1): p. 164-72.
Peviani, S.M., et al., Short bouts of stretching increase myo-D, myostatin and atrogin-1 in rat soleus muscle. Muscle & Nerve, 2007. 35(3): p. 363370.
Miyata, T., S. Tanaka, and K. Tachino, MyoD and myogenin mRNA levels after single session of treadmill exercise in rat skeletal muscle. Journal of physical therapy science, 2009. 21(1): p. 81-84.

  • 1

پاسخ دهید